Top » Catalog » R1b » A8

$18.00

A8
[A8]

A8
hg38 Position: ChrY:15906363..15906363
Ancestral: T
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a1a
Comments: Found in a R1b-L513 person
Forward Primer: A8_F GGCACAGGTTAACTGGGTTC
Reverse Primer: A8_R GCCACCTCCTGAACTGTCAC
Reviews

Customers who bought this product also purchased
Z17294
Z17294
Z17296
Z17296
S5668
S5668
FGC11134
FGC11134
A2158
A2158
L21
L21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies