Top » Catalog » R1b » A8

$18.00

A8
[A8]

A8
hg38 Position: ChrY:15906363..15906363
Ancestral: T
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a1a
Comments: Found in a R1b-L513 person
Forward Primer: A8_F GGCACAGGTTAACTGGGTTC
Reverse Primer: A8_R GCCACCTCCTGAACTGTCAC
Reviews

Customers who bought this product also purchased
A2158
A2158
L21
L21
FGC32805
FGC32805
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF21
DF21
Z253
Z253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies