Top » Catalog » R1b » A9

$18.00

A9
[A9]

A9
hg38 Position: ChrY:16664442..16664442
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a1a
Comments: Found in a R1b-L513 person
Forward Primer: A9_F GCTCTGCTTTTCCAACATTGTC
Reverse Primer: A9_R TTTTGGTACAAAAGTGCAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies