Top » Catalog » R1b » A9

$18.00

A9
[A9]

A9
hg38 Position: ChrY:16664442..16664442
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a1a
Comments: Found in a R1b-L513 person
Forward Primer: A9_F GCTCTGCTTTTCCAACATTGTC
Reverse Primer: A9_R TTTTGGTACAAAAGTGCAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A121
1 x A1321
1 x A1544
1 x A2143
1 x A765
1 x A1164
1 x A682
1 x A636
1 x A326
1 x A190
1 x A227
1 x A443
1 x A660
1 x A300
1 x A1223
1 x A20
1 x A412
1 x A2181
1 x A971
1 x A154
1 x A953
1 x A218
1 x A768
1 x A130
1 x A236
1 x A336
$468.00
Haplogroup Info
Other products
Currencies