Top » Catalog » R1b » A324

$18.00

A324
[A324]

A324
hg38 Position: ChrY:17127179..17127179
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: DYS541
Forward Primer: A324_F GTGAATAATCTTTTTTCTTCATTCTCAAC
Reverse Primer: A324_R TTAAGAAGCCTTCACCTAACATCAC
Reviews

Customers who bought this product also purchased
YSC0000221
YSC0000221
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1225
$18.00
Haplogroup Info
Other products
Currencies