Top » Catalog » R1b » A119

$18.00

A119
[A119]

A119
hg38 Position: ChrY:8323062..8323062
Ancestral: C
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A119_F AATAAAGTATTTTCAGGTATCTTTAGCCC
Reverse Primer: A119_R GCCCTGTTATGAAACTCTGTGTAAC
Reviews

Customers who bought this product also purchased
A120
A120
A143
A143
A129
A129
A135
A135
A117
A117
A142
A142
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies