Top » Catalog » R1b » A120

$18.00

A120
[A120]

A120
hg38 Position: ChrY:8523646..8523646
Ancestral: T
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A120_F GTGGTTCTTGGCTATGGGTC
Reverse Primer: A120_R CCTTAGAATGGGGCAGCTC
Reviews

Customers who bought this product also purchased
A125
A125
S2202
S2202
A131
A131
A137
A137
A121
A121
A144
A144
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies