Top » Catalog » R1b » A121

$18.00

A121
[A121]

A121
hg38 Position: ChrY:8598856..8598856
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A121_F TATTTCGGGATTTCCATTGC
Reverse Primer: A121_R TCTGGCAGTCTCTGTGGTTG
Reviews

Customers who bought this product also purchased
A135
A135
A117
A117
A142
A142
A128
A128
A133
A133
A139
A139
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies