Top » Catalog » R1b » A125

$18.00

A125
[A125]

A125
hg38 Position: ChrY:10154462..10154462
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496 person. Also found in J1-YSC76
Forward Primer: A125_F GGCTGGAGTGCAATGGAG
Reverse Primer: A125_R AGATCTAAGAACCAATGAACCCCTAT
Reviews

Customers who bought this product also purchased
A625
A625
A633
A633
A639
A639
A613
A613
A632
A632
A638
A638
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14645
1 x A20817
1 x A19334
1 x A19281
1 x A19277
1 x A13641
1 x A15553
1 x A17831
1 x A12925
1 x A14644
1 x A13647
1 x A18932
1 x A19279
1 x A20820
1 x A19274
1 x A18468
1 x A15547
1 x A12921
1 x A15548
1 x A13649
1 x A18931
1 x A19931
1 x A17372
1 x A13639
1 x A12919
1 x A19275
1 x A10970
1 x A13645
1 x A14648
1 x A18555
1 x A19336
1 x A20954
1 x A13638
1 x A19929
1 x A18940
1 x A14641
1 x A15551
1 x A17833
1 x A19335
1 x A13637
1 x A18939
1 x A14639
1 x A12918
1 x A19218
1 x A16982
1 x A19280
1 x A19263
1 x A21955
1 x A15550
1 x A18554
1 x A13633
1 x A13635
1 x A13650
$954.00
Haplogroup Info
Other products
Currencies