Top » Catalog » R1b » A125

$18.00

A125
[A125]

A125
hg38 Position: ChrY:10154462..10154462
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496 person. Also found in J1-YSC76
Forward Primer: A125_F GGCTGGAGTGCAATGGAG
Reverse Primer: A125_R AGATCTAAGAACCAATGAACCCCTAT
Reviews

Customers who bought this product also purchased
A637
A637
R1b-CTS6889 / CTS11824 downstream
R1b-CTS6889 / CTS11824 downstream
A629
A629
A636
A636
S1141
S1141
A627
A627
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A97
1 x A48
1 x A120
1 x A14
1 x A47
1 x A119
1 x A95
1 x A155
1 x A94
1 x A93
1 x A136
1 x A101
1 x A92
1 x A135
1 x A43
1 x A60
1 x A3
1 x A133
1 x A162
1 x A151
1 x A81
1 x A146
1 x A132
1 x A167
1 x A33
1 x A6
1 x A58
1 x A99
1 x A131
1 x A149
1 x A77
1 x A109
1 x A163
1 x A179
1 x A57
1 x A130
1 x A161
1 x A50
1 x A71
1 x A157
1 x A104
$738.00
Haplogroup Info
Other products
Currencies