Top » Catalog » R1b » A125

$18.00

A125
[A125]

A125
hg38 Position: ChrY:10154462..10154462
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496 person. Also found in J1-YSC76
Forward Primer: A125_F GGCTGGAGTGCAATGGAG
Reverse Primer: A125_R AGATCTAAGAACCAATGAACCCCTAT
Reviews

Customers who bought this product also purchased
A631
A631
A637
A637
R1b-CTS6889 / CTS11824 downstream
R1b-CTS6889 / CTS11824 downstream
A629
A629
A636
A636
S1141
S1141
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies