Top » Catalog » R1b » A125

$18.00

A125
[A125]

A125
hg38 Position: ChrY:10154462..10154462
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496 person. Also found in J1-YSC76
Forward Primer: A125_F GGCTGGAGTGCAATGGAG
Reverse Primer: A125_R AGATCTAAGAACCAATGAACCCCTAT
Reviews

Customers who bought this product also purchased
A636
A636
S1141
S1141
A627
A627
A635
A635
A640
A640
A625
A625
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies