Top » Catalog » R1b » A128

$18.00

A128
[A128]

A128
hg38 Position: ChrY:12919581..12919581
Ancestral: A
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A128_F AAACTGCACAAGGTGTGTGTTC
Reverse Primer: A128_R AAGATTGGAAGGTCGAGGAC
Reviews

Customers who bought this product also purchased
A130
A130
A136
A136
A119
A119
A143
A143
A129
A129
A135
A135
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14645
1 x A20817
1 x A19334
1 x A19281
1 x A19277
1 x A13641
1 x A15553
1 x A17831
1 x A12925
1 x A14644
1 x A13647
1 x A18932
1 x A19279
1 x A20820
1 x A19274
1 x A18468
1 x A15547
1 x A12921
1 x A15548
1 x A13649
1 x A18931
1 x A19931
1 x A17372
1 x A13639
1 x A12919
1 x A19275
1 x A10970
1 x A13645
1 x A14648
1 x A18555
1 x A19336
1 x A20954
1 x A13638
1 x A19929
1 x A18940
1 x A14641
1 x A15551
1 x A17833
1 x A19335
1 x A13637
1 x A18939
1 x A14639
1 x A12918
1 x A19218
1 x A16982
1 x A19280
1 x A19263
1 x A21955
1 x A15550
1 x A18554
1 x A13633
1 x A13635
1 x A13650
$954.00
Haplogroup Info
Other products
Currencies