Top » Catalog » R1b » A129

$18.00

A129
[A129]

A129
hg38 Position: ChrY:13026782..13026782
Ancestral: C
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A129_F AATGTACGTGCCCTGAAAATC
Reverse Primer: A129_R TCAAGGAGGGAAACAAGGAC
Reviews

Customers who bought this product also purchased
A136
A136
A119
A119
A143
A143
A128
A128
A135
A135
A117
A117
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies