Top » Catalog » R1b » A130

$18.00

A130
[A130]

A130
hg38 Position: ChrY:13336548..13336548
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A130_F TATCATGGGAGCTGAAATGC
Reverse Primer: A130_R TGCATAGTCTGTGGCTTATTGTG
Reviews

Customers who bought this product also purchased
A132
A132
A138
A138
A121
A121
S2202
S2202
A131
A131
A137
A137
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies