Top » Catalog » R1b » A1742

$18.00

A1742
[A1742]

A1742
hg38 Position: ChrY:12023990..12023990
Ancestral: T
Derived: G
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a2b1~
Comments: Below S603
Forward Primer: A1742_F CCCAAAACCCCAATATGTCC
Reverse Primer: A1742_R AAATAAAATGTGGACTCTCATAGGC
Reviews

Customers who bought this product also purchased
FGC4113
FGC4113
FGC23592
FGC23592
DNA Sample Kit
DNA Sample Kit
FGC23595
FGC23595
Wish a Panel
Wish a Panel
A1743
A1743
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1721
1 x A1036
1 x A1163
1 x A2155
1 x A113
1 x A1758
$108.00
Haplogroup Info
Other products
Currencies