Top » Catalog » R1b » A132

$18.00

A132
[A132]

A132
hg38 Position: ChrY:13861414..13861414
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A132_F TTGGAATGGTCTTTTTAAAACCAG
Reverse Primer: A132_R AATCTATTGACTTGATGGTCTTCATTAAG
Reviews

Customers who bought this product also purchased
A125
A125
A131
A131
A138
A138
A121
A121
S2202
S2202
A130
A130
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A486
1 x A1483
1 x A380
$54.00
Haplogroup Info
Other products
Currencies