Top » Catalog » R1b » A132

$18.00

A132
[A132]

A132
hg38 Position: ChrY:13861414..13861414
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A132_F TTGGAATGGTCTTTTTAAAACCAG
Reverse Primer: A132_R AATCTATTGACTTGATGGTCTTCATTAAG
Reviews

Customers who bought this product also purchased
A129
A129
A136
A136
A119
A119
A143
A143
A128
A128
A135
A135
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies