Top » Catalog » R1b » A1770

$18.00

A1770
[A1770]

A1770
hg38 Position: ChrY:7497370..7497370
Ancestral: C
Derived: T
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. L257
Forward Primer: A1770_F TCATGTCATTGTTGCTGATAGTACAG
Reverse Primer: A1770_R AGAATAGAGACACTCATATAGTTGCCA
Reviews

Customers who bought this product also purchased
PF1237
PF1237
FGC15283
FGC15283
FGC15284
FGC15284
A508
A508
A1771
A1771
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A635
1 x A677
1 x A2127
1 x A104
1 x A952
1 x A966
1 x A800
1 x A183
1 x A2156
$162.00
Haplogroup Info
Other products
Currencies