Top » Catalog » R1b » A133

$18.00

A133
[A133]

A133
hg38 Position: ChrY:13881516..13881516
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A133_F AGTTTTATGGGAACATAGCCACC
Reverse Primer: A133_R CTTTAGGGGTCAGAGAGGTAAACAG
Reviews

Customers who bought this product also purchased
A130
A130
A137
A137
A120
A120
A144
A144
A129
A129
A136
A136
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A486
1 x A1483
1 x A380
$54.00
Haplogroup Info
Other products
Currencies