Top » Catalog » R1b » A761

$18.00

A761
[A761]

A761
hg38 Position: ChrY:11370651..11370651
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a
Comments: Found in CTS4466 individuals below A195
Forward Primer: A761_F GGGCATGGCTTAGTTGTATGT
Reverse Primer: A761_R AAATGAATTTTATAATCAGCATTTCATG
Reviews

Customers who bought this product also purchased
Z253
Z253
Z255
Z255
Z39589
Z39589
FGC11134
FGC11134
DF49
DF49
L513
L513
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A749
$18.00
Haplogroup Info
Other products
Currencies