Top » Catalog » R1b » A761

$18.00

A761
[A761]

A761
hg38 Position: ChrY:11370651..11370651
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a
Comments: Found in CTS4466 individuals below A195
Forward Primer: A761_F GGGCATGGCTTAGTTGTATGT
Reverse Primer: A761_R AAATGAATTTTATAATCAGCATTTCATG
Reviews

Customers who bought this product also purchased
L513
L513
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF21
DF21
A12590
A12590
L21
L21
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2194
1 x A887
1 x A987
1 x A2201
1 x A458
1 x A189
1 x A1729
1 x A560
1 x A2070
$162.00
Haplogroup Info
Other products
Currencies