Top » Catalog » R1b » A135

$18.00

A135
[A135]

A135
hg38 Position: ChrY:14141201..14141201
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A135_F AGCTCCTCAACCCTCTACCC
Reverse Primer: A135_R GCCAGATGACTGTTCGAGTG
Reviews

Customers who bought this product also purchased
A137
A137
A120
A120
A144
A144
A129
A129
A136
A136
A119
A119
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies