Top » Catalog » R1b » A1772

$18.00

A1772
[A1772]

A1772
hg38 Position: ChrY:10169667..10169667
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Under Z251 > FGC13899 > A228 > A959
Forward Primer: A1772_F CTTCCTCCTTCAGCTTCGG
Reverse Primer: A1772_R CACCATCATCGCTTCTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies