Top » Catalog » R1b » A1773

$18.00

A1773
[A1773]

A1773
hg38 Position: ChrY:7804095..7804095
Ancestral: C
Derived: T
Reference: Vladimir S. Vengertsev (2015)
ISOGG Haplogroup: R1b1a2a1a2b1c (not listed)
Comments: .
Forward Primer: A1773_F TAGGACAAGACCCAGGCAAG
Reverse Primer: A1773_R GAATGGGCTGTACTCACACTAGG
Reviews

Customers who bought this product also purchased
A274
A274
A517
A517
S20550
S20550
CTS11993
CTS11993
Z56
Z56
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2270
1 x A1299
1 x A1779
1 x A578
1 x A733
1 x A322
1 x A585
1 x A446
1 x A1070
1 x A256
1 x A1126
1 x A2231
1 x A25
1 x A922
1 x A2202
1 x A766
1 x A1706
1 x A433
1 x A1001
1 x A1487
1 x A989
$378.00
Haplogroup Info
Other products
Currencies