Top » Catalog » R1b » A136

$18.00

A136
[A136]

A136
hg38 Position: ChrY:15883660..15883660
Ancestral: C
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A136v2_F CAGAATATACATCTCAATTAACACTTCAG
Reverse Primer: A136v2_R TTTGACTATGTTGTATACGTCTCATCTAG
Reviews

Customers who bought this product also purchased
A117
A117
A142
A142
A127
A127
A132
A132
A139
A139
A125
A125
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies