Top » Catalog » R1b » A1774

$18.00

A1774
[A1774]

A1774
hg38 Position: ChrY:15555656..15555656
Ancestral: A
Derived: T
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Branch below R1b-A224
Forward Primer: A1774_F TCCTTTAAGCAACTATTTATTGGTCTG
Reverse Primer: A1774_R GGCTGAACACTGGCACTGA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A597
$18.00
Haplogroup Info
Other products
Currencies