Top » Catalog » R1b » A1775

$18.00

A1775
[A1775]

A1775
hg38 Position: ChrY:16613961..16613961
Ancestral: T
Derived: C
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Branch below R1b-A224
Forward Primer: A1775_F AAGGGGTTTAAATTCCTCACTACAC
Reverse Primer: A1775_R CTCAGTGCTTGGCACCAAC
Reviews

Customers who bought this product also purchased
ZS8379
ZS8379
A984
A984
A738
A738
A10528
A10528
Z39589
Z39589
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A599
1 x A212
1 x A586
1 x A232
1 x A295
1 x A193
1 x A308
1 x A1280
1 x A2196
1 x A22
1 x A156
1 x A1506
1 x A319
1 x A155
1 x A885
1 x A470
1 x A323
$306.00
Haplogroup Info
Other products
Currencies