Top » Catalog » R1b » A1775

$18.00

A1775
[A1775]

A1775
hg38 Position: ChrY:16613961..16613961
Ancestral: T
Derived: C
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Branch below R1b-A224
Forward Primer: A1775_F AAGGGGTTTAAATTCCTCACTACAC
Reverse Primer: A1775_R CTCAGTGCTTGGCACCAAC
Reviews

Customers who bought this product also purchased
A23675
A23675
A18726
A18726
A10528
A10528
ZS8379
ZS8379
A984
A984
A738
A738
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies