Top » Catalog » R1b » A1777

$19.00

A1777
[A1777]

A1777
hg38 Position: ChrY:13045319..13045319
Ancestral: T
Derived: C
Reference: Atanas Kumbarov (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Under CTS9219 parallel to BY250 and Y5587
Forward Primer: A1777_F TTCCCCATAGCAACTGGAAG
Reverse Primer: A1777_R TCAACTTGAACATTATTGCTGTACC
Reviews (1)

Customers who bought this product also purchased
Y32825
Y32825
Y23493
Y23493
PF6285
PF6285
Y19971
Y19971
FGC41543
FGC41543
Y29918
Y29918
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies