Top » Catalog » R1b » A1777

$18.00

A1777
[A1777]

A1777
hg38 Position: ChrY:13045319..13045319
Ancestral: T
Derived: C
Reference: Atanas Kumbarov (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Under CTS9219 parallel to BY250 and Y5587
Forward Primer: A1777_F TTCCCCATAGCAACTGGAAG
Reverse Primer: A1777_R TCAACTTGAACATTATTGCTGTACC
Reviews (1)

Customers who bought this product also purchased
Z2106
Z2106
Y19469
Y19469
Y15982
Y15982
BY250
BY250
CTS9219
CTS9219
PH1723
PH1723
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies