Top » Catalog » R1b » A1777

$18.00

A1777
[A1777]

A1777
hg38 Position: ChrY:13045319..13045319
Ancestral: T
Derived: C
Reference: Atanas Kumbarov (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Under CTS9219 parallel to BY250 and Y5587
Forward Primer: A1777_F TTCCCCATAGCAACTGGAAG
Reverse Primer: A1777_R TCAACTTGAACATTATTGCTGTACC
Reviews (1)

Customers who bought this product also purchased
Y19469
Y19469
Y15982
Y15982
Z2106
Z2106
R1b-Z2103 Panel
R1b-Z2103 Panel
Y5586
Y5586
Y16145
Y16145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2184
1 x A1332
1 x A2248
1 x A1338
1 x A2195
1 x A880
1 x A468
$126.00
Haplogroup Info
Other products
Currencies