Top » Catalog » R1b » A1777

$18.00

A1777
[A1777]

A1777
hg38 Position: ChrY:13045319..13045319
Ancestral: T
Derived: C
Reference: Atanas Kumbarov (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Under CTS9219 parallel to BY250 and Y5587
Forward Primer: A1777_F TTCCCCATAGCAACTGGAAG
Reverse Primer: A1777_R TCAACTTGAACATTATTGCTGTACC
Reviews (1)

Customers who bought this product also purchased
BY251
BY251
A23083
A23083
Y85047
Y85047
Y153706
Y153706
BY199059
BY199059
FT51313
FT51313
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies