Top » Catalog » R1b » A1784

$18.00

A1784
[A1784]

A1784
hg38 Position: ChrY:11887188..11887188
Ancestral: T
Derived: C
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1784_F AGAAAACCTCACTTTGACCTGG
Reverse Primer: A1784_R TTTTGAGTAATAGCAAGGTTTATTGTG
Reviews

Customers who bought this product also purchased
A1782
A1782
A1781
A1781
A1779
A1779
A1778
A1778
A1785
A1785
A1783
A1783
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies