Top » Catalog » R1b » A1786

$18.00

A1786
[A1786]

A1786
hg38 Position: ChrY:6874039..6874039
Ancestral: A
Derived: T
Reference: Christopher McCown (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1i4a
Comments: Beneath DF41 > A874
Forward Primer: A1786_F CAACAGAAGTAACTGATTCTTAACAGC
Reverse Primer: A1786_R TTAAAAACAGTGCAATGAAGTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies