Top » Catalog » R1b » A1787

$18.00

A1787
[A1787]

A1787
hg38 Position: ChrY:8512040..8512040
Ancestral: C
Derived: T
Reference: Christopher McCown (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1i4a~
Comments: Beneath DF41 > A874
Forward Primer: A1787_F TCTTCTACATCAGCCTCGTGG
Reverse Primer: A1787_R TGTCACCATATTTTATCCTAAGGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A636
$18.00
Haplogroup Info
Other products
Currencies