Top » Catalog » R1b » A138

$19.00

A138
[A138]

A138
hg38 Position: ChrY:17278681..17278681
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A138_F ATTGGGACTTGTTAATGGTCTC
Reverse Primer: A138_R GAAGGACAACAAATTGAGAAACG
Reviews

Customers who bought this product also purchased
A135
A135
A119
A119
A143
A143
A128
A128
A133
A133
A117
A117
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies