Top » Catalog » R1b » A138

$18.00

A138
[A138]

A138
hg38 Position: ChrY:17278681..17278681
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A138_F ATTGGGACTTGTTAATGGTCTC
Reverse Primer: A138_R GAAGGACAACAAATTGAGAAACG
Reviews

Customers who bought this product also purchased
A121
A121
S2202
S2202
A130
A130
A136
A136
A120
A120
A144
A144
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies