Top » Catalog » R1b » A139

$18.00

A139
[A139]

A139
hg38 Position: ChrY:19164857..19164857
Ancestral: C
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496 person
Forward Primer: A139_F GCATGCACCTGTAATCCCTAC
Reverse Primer: A139_R TGGTTCCTCCATTTCCAGAG
Reviews

Customers who bought this product also purchased
A120
A120
A144
A144
A129
A129
A135
A135
A119
A119
A143
A143
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies