Top » Catalog » R1b » A2070

$18.00

A2070
[A2070]

A2070
hg38 Position: ChrY:12348852..12348852
Ancestral: G
Derived: A
Reference: Thomas Krahn (2012)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream MC14
Forward Primer: A2070_F TGTTCTCCCCAGCTCTGAAC
Reverse Primer: A2070_R TTAGTCGAGCATGGAGCAAG
Reviews

Customers who bought this product also purchased
A7300
A7300
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2226
1 x A2267
1 x A1056
1 x A746
1 x A792
1 x A1507
1 x A1309
1 x A986
1 x A1302
1 x A450
1 x A715
1 x A2265
1 x A1540
1 x A963
1 x A19
1 x A352
1 x A1324
$306.00
Haplogroup Info
Other products
Currencies