Top » Catalog » R1b » A142

$18.00

A142
[A142]

A142
hg38 Position: ChrY:20390461..20390461
Ancestral: T
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A142_F TCTCTTTTACTGGGCTGATTTG
Reverse Primer: A142_R AGGTGTTCTCGGTTTGATGTC
Reviews

Customers who bought this product also purchased
A130
A130
A136
A136
A120
A120
A144
A144
A129
A129
A135
A135
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies