Top » Catalog » R1b » A2072

$18.00

A2072
[A2072]

A2072
hg38 Position: ChrY:7640691..7640691
Ancestral: T
Derived: C
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: Downstream L257
Forward Primer: A2072_F TATGCCTTGAGCTTTTTTTGATG
Reverse Primer: A2072_R GTTTTTTGATGGTCTCAAATCTTGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A789
1 x A432
1 x A120
1 x A545
1 x A734
1 x A662
1 x A245
1 x A96
1 x A1260
$162.00
Haplogroup Info
Other products
Currencies