Top » Catalog » R1b » A2075

$18.00

A2075
[A2075]

A2075
hg38 Position: ChrY:13169392..13169392
Ancestral: G
Derived: A
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: Downstream L257
Forward Primer: A2075_F TTTAAGAGGCCTTCAGTTTTTG
Reverse Primer: A2075_R CATGCTTGTGGAAGTACCTTTTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2270
1 x A1299
1 x A1779
1 x A578
1 x A733
1 x A322
1 x A585
1 x A446
1 x A1070
1 x A256
1 x A1126
1 x A2231
1 x A25
1 x A922
1 x A2202
1 x A766
1 x A1706
1 x A433
1 x A1001
$342.00
Haplogroup Info
Other products
Currencies