Top » Catalog » R1b » A143

$18.00

A143
[A143]

A143
hg38 Position: ChrY:21855811..21855815
Ancestral: del
Derived: ins
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496 person
Forward Primer: A143_F AGAAAACTTGTTTTGCTGAGACC
Reverse Primer: A143_R AGGCCAACCTCCTAACCG
Reviews

Customers who bought this product also purchased
A117
A117
A139
A139
A127
A127
A132
A132
A138
A138
A125
A125
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A47
1 x A162
1 x A30
1 x A95
1 x A135
1 x A189
1 x A91
1 x A57
1 x A190
1 x A81
1 x A151
1 x A129
1 x A166
1 x A146
1 x A130
1 x A33
1 x A191
1 x A156
1 x A25
1 x A20
1 x A154
1 x A148
1 x A41
1 x A48
1 x A89
1 x A186
1 x A103
1 x A90
1 x A187
1 x A192
1 x A169
1 x A155
1 x A22
1 x A142
1 x A59
1 x A170
1 x A153
1 x A19
1 x A100
1 x A34
1 x A7
1 x A139
1 x A144
1 x A173
1 x A185
1 x A193
1 x A163
1 x A157
1 x A67
1 x A63
1 x A150
1 x A35
1 x A40
1 x A55
$972.00
Haplogroup Info
Other products
Currencies