Top » Catalog » R1b » A143

$18.00

A143
[A143]

A143
hg38 Position: ChrY:21855811..21855815
Ancestral: del
Derived: ins
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496 person
Forward Primer: A143_F AGAAAACTTGTTTTGCTGAGACC
Reverse Primer: A143_R AGGCCAACCTCCTAACCG
Reviews

Customers who bought this product also purchased
A131
A131
A137
A137
A121
A121
S2202
S2202
A130
A130
A136
A136
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies