Top » Catalog » R1b » A2076

$18.00

A2076
[A2076]

A2076
hg38 Position: ChrY:14644533..14644533
Ancestral: A
Derived: G
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: Downstream L257
Forward Primer: A2076_F AGCAAGCTGGGGAGGTATG
Reverse Primer: A2076_R ATGCTGTCCACACTTGCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies