Top » Catalog » R1b » A2078

$18.00

A2078
[A2078]

A2078
hg38 Position: ChrY:15783163..15783163
Ancestral: C
Derived: A
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: Downstream L257
Forward Primer: A2078_F ATCACATTGGTGGTGTTCTTCTC
Reverse Primer: A2078_R CATTATAGGCAAAAGGAAGTTAAAAGA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies