Top » Catalog » R1b » A2079

$18.00

A2079
[A2079]

A2079
hg38 Position: ChrY:19141736..19141736
Ancestral: C
Derived: T
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: Downstream L257
Forward Primer: A2079_F AACCGGGATGAATTAGTTTGG
Reverse Primer: A2079_R AGGAGGAGGAACGATGAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies