Top » Catalog » R1b » A2080

$18.00

A2080
[A2080]

A2080
hg38 Position: ChrY:21323363..21323363
Ancestral: C
Derived: A
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: Downstream L257
Forward Primer: A2080_F ACATTCTTACTGAACTTTATAAATGACTCAG
Reverse Primer: A2080_R CCAGCCTGGCCATTATGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2203
1 x A8
1 x A364
1 x A2209
1 x A1241
1 x A226
1 x A259
1 x A667
1 x A673
1 x A2240
1 x A1316
1 x A1310
1 x A178
1 x A1129
1 x A1330
1 x A167
1 x A1206
$306.00
Haplogroup Info
Other products
Currencies