Top » Catalog » R1b » A2117

$19.00

A2117
[A2117]

A2117
hg38 Position: ChrY:15635627..15635627
Ancestral: T
Derived: A
Reference: Larry W. Rodgers (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below CTS4931
Forward Primer: A2117_F ACTCTTTGCTAGGCACCAGG
Reverse Primer: A2117_R GTTGAATTAACTGAAATCCTTGGC
Reviews

Customers who bought this product also purchased
A2118
A2118
A2119
A2119
A2116
A2116
A2120
A2120
A5306
A5306
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies