Top » Catalog » R1b » A2119

$18.00

A2119
[A2119]

A2119
hg38 Position: ChrY:16557361..16557361
Ancestral: C
Derived: T
Reference: Larry W. Rodgers (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below CTS4931
Forward Primer: A2119_F CCAGACAGGCTTCTCTCACTTAG
Reverse Primer: A2119_R CCAGAGCTCCCATTTACTGC
Reviews

Customers who bought this product also purchased
A5306
A5306
A2118
A2118
A2117
A2117
A2116
A2116
A2120
A2120
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies