Top » Catalog » R1b » A161

$18.00

A161
[A161]

A161
hg38 Position: ChrY:19697146..19697147
Ancestral: del
Derived: ins
Reference: Mike Walsh et al. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k1a
Comments: Probably phylo-equivalent to S744
Forward Primer: A161_F TGGGAAAGCATTTCTTGGAC
Reverse Primer: A161_R TGCTCCACACTTTCACCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A486
1 x A1483
1 x A380
$54.00
Haplogroup Info
Other products
Currencies